Cuban Journal of Agricultural Science Vol. 59, January-December 2025, ISSN: 2079-3480
Código QR
Cu-ID: https://cu-id.com/1996/v59e17
Pasture Sciences and Other Crops

Evaluation of ASGR p779/p780 primers in the determination of aposporic apomixis in Cenchrus purpureus

 

iDA. R. Hernández Montesinos1Instituto de Ciencia Animal, C. Central, km 47 ½, San José de las Lajas, C.P. 32700, Mayabeque, Cuba*✉:andresraulhm@gmail.com

iDMaría E. Recio2Centro Internacional de Agricultura Tropical, km 17, Recta, Cali-Palmira, C.P.763537, Valle del Cauca, Colombia

iDMónica Carvajal-Yepes2Centro Internacional de Agricultura Tropical, km 17, Recta, Cali-Palmira, C.P.763537, Valle del Cauca, Colombia

iDJ. Arango2Centro Internacional de Agricultura Tropical, km 17, Recta, Cali-Palmira, C.P.763537, Valle del Cauca, Colombia

iDDaymara Rodríguez Alfonso3Universidad Agraria de La Habana, A. Nacional, km 23 ½, San José de las Lajas, C.P. 32700, Mayabeque, Cuba

iDDayleni Fortes González1Instituto de Ciencia Animal, C. Central, km 47 ½, San José de las Lajas, C.P. 32700, Mayabeque, Cuba

iDR. S. Herrera García1Instituto de Ciencia Animal, C. Central, km 47 ½, San José de las Lajas, C.P. 32700, Mayabeque, Cuba


1Instituto de Ciencia Animal, C. Central, km 47 ½, San José de las Lajas, C.P. 32700, Mayabeque, Cuba

2Centro Internacional de Agricultura Tropical, km 17, Recta, Cali-Palmira, C.P.763537, Valle del Cauca, Colombia

3Universidad Agraria de La Habana, A. Nacional, km 23 ½, San José de las Lajas, C.P. 32700, Mayabeque, Cuba

 

*Email: andresraulhm@gmail.com

Abstract

The objective of this study was to evaluate the molecular markers ASGR p779/p780, specific for aposporic apomixis, in the determination of the type of reproduction in accessions of Cenchrus purpureus. The study was conducted at the Alliance of Bioversity International and the International Center for Tropical Agriculture. The samples under study come from 62 accessions of C. purpureus from the Germplasm Bank of Grasses and Forages of Instituto de Ciencia Animal. The type of reproduction of the accessions was determined by Polymerase Chain Reaction (PCR) with the combination of direct and reverse primers p779/p780 completely linked to the aposporic apomixis. It was not obtained DNA amplification from the C. purpureus accessions and the Urochloa spp. controls that were negative for aposporic apomixis. However, DNA amplification was obtained from positive controls to aposporic apomixis in Urochloa spp. accessions reported as apomictic. The amplification products revealed a well-defined polymorphic band on the gels with an approximate size of 950 base pairs. The p779/p780 primers amplified the apomixis-positive Urochloa accessions, but did not amplify the negative controls or the C. purpureus accessions. These results suggest that (I) or the 62 accessions of C. purpureus from ICA reproduce sexually and do not exhibit aposporic apomixis, or that (II) the primers are not specific to this species.

Key words: 
DNA, molecular marker, PCR, reproduction, Urochloa

Received: 20/7/2025; Accepted: 22/9/2025

Conflict of interest: The authors declare that there is not conflict of interest.

CRediT Authorship Contribution Statement: Conceptualization, Visualization, Investigation, Writing - original draft: A. R. Hernández Montesinos. Investigation, Supervision, Writing - original draft: María E. Recio, Mónica Carvajal-Yepes, J. Arango. Investigation: Daymara Rodríguez Alfonso. Investigation, Writing - original draft: Dayleni Fortes González, R. S. Herrera García.

CONTENT

Introduction

 

The species Cenchrus purpureus (Schumach) Morrone is native to Tropical Africa. It is a perennial or rhizomatous geophyte and grows mainly in the seasonally dry tropical biome. It is used as animal food and in medicine; it has environmental and social uses, and is used as fuel (POWO 2025POWO. 2025. Plants of the World Online. Kew Royal Botanic Gardens. Available at: https://powo.science.kew.org/taxon/urn:lsid:ipni.org:names:77106033-1 [Consulted: July 15, 2025]. ). In C. purpureus there are two types of reproduction: sexual (by seeds) and asexual (by vegetative cuttings) (Wessapak et al. 2023Wessapak, P., Ngernsaengsaruay, C. & Duangjai, S. 2023. A taxonomic revision of Cenchrus L. (Poaceae) in Thailand, with lectotypification of Pennisetum macrostachyum Benth. PhytoKeys, 234: 1-33, ISSN: 1314-2003. https://doi.org/10.3897/phytokeys.234.106486. ).

Apomixis is the phenomenon of clonal reproduction by seed and occurs naturally in more than 400 plant species (Xu et al. 2022Xu, Y., Jia, H., Tan, C., Wu, X., Deng, X. & Xu, Q. 2022. Apomixis: genetic basis and controlling genes. Horticulture Research, 9: 1-10, ISSN: 2052-7276. https://doi.org/10.1093/hr/uhac150.). In the genus Cenchrus, it is estimated that at least eight species exhibit apomixis, although the numerical accuracy varies due to the biological complexity of the phenomenon and the presence of facultative reproductive modes (combination of apomixis and sexuality) in several species (Kumar et al. 2019Kumar, S., Saxena, S., Rai, A., Radhakrishna, A. & Kaushal, P. 2019. Ecological, genetic, and reproductive features of Cenchrus species indicate evolutionary superiority of apomixis under environmental stresses. Ecological Indicators, 105: 126-136, ISSN: 1872-7034. https://doi.org/10.1016/j.ecolind.2019.05.036. ).

The identification studies of apomixis in C. purpureus were carried out by Hanna (1981)Hanna, W.W. 1981. Method of reproduction in napiergrass and in the 3x and 6x alloploid hybrids with pearl millet. Crop Science, 21: 123-126, ISSN: 1435-0653. https://doi.org/10.2135/cropsci1981.0011183X002100010033x. and González and Hanna (1984)González, B. & Hanna, W.W. 1984. Morphological and fertility responses in isogenic triploid and hexaploid pearl millet x napiergrass hybrids. Journal of Heredity, 75(4): 317-318, ISSN: 1465-7333. http://jhered.oxfordjournals.org/. for which they used morphological markers and determined in all cases the form of sexual reproduction in accessions of C. purpureus and hybrids of C. purpureus x Cenchrus americanus (L.) Morrone. However, genetic information on the presence of genomic regions involved in this mode of reproduction has not been described in C. purpureus.

Among the molecular markers linked to the mode of reproduction in apomictic species in Poaceae, there is the ASGR (apospory-specific genomic region) p779/p780 specific for aposporic apomixis. Developed by Akiyama et al. (2011)Akiyama, Y., Goel, S., Conner, J.A., Hanna, W.W., Yamada-Akiyama, H. & Ozias-Akins, P. 2011. Evolution of the apomixis transmitting chromosome in Pennisetum. BMC Evolutionary Biology, 11: 1-16, ISSN: 1471-2148. http://www.biomedcentral.com/1471-2148/11/289. , from sequences of exons four and seven of the ASGR-BBM-like2 gene of Pennisetum squamulatum (L.) syn. Cenchrus squamulatus (Fresen.) Morrone and which amplifies a region that includes three introns of 950, 266 and 154 base pairs (bp).

The ASGR p779/p780 primers were used to determine the mode of reproduction of accessions of Megathyrsus maximus (Jacq.) B.K.Simon & S.W.L.Jacobs and four species of Urochloa (Urochloa brizantha (A. Rich.) R. D. Webster, Urochloa decumbens (Stapf) R. D. Webster, Urochloa humidicola (Rendle) Morrone & Zuloaga and Urochloa ruziziensis (R. Germ. & C. M. Evrard) Crins) from the Genetic Resources Program of the Alliance of Bioversity International and the International Center for Tropical Agriculture (Alliance), in Colombia (Worthington et al. 2016Worthington, M., Heffelfinger, C., Bernal, D., Quintero, C., Zapata, Y.P., Perez, J.G., De Vega, J., Miles, J., Dellaporta, S. & Tohme, J. 2016. A parthenogenesis gene candidate and evidence for segmental allopolyploidy in apomictic Brachiaria decumbens. Genetics, 203(3): 1117-1132, ISSN: 3049-7094. https://doi.org/10.1534/genetics.116.190314. and Worthington et al. 2019Worthington, M., Ebina, M., Yamanaka, N., Heffelfinger, C., Quintero, C., Zapata, Y. P., Perez, J.G., Selvaraj, M., Ishitani, M., Duitama, J., de la Hoz, J.F., Rao, I., Dellaporta, S., Tohme, J. & Arango, J. 2019. Translocation of a parthenogenesis gene candidate to analternate carrier chromosome in apomictic Brachiaria humidicola. BMC genomics, 20(41): 1-18, ISSN: 1471-2164. https://doi.org/10.1186/s12864-018-5392-4. ).

There are few studies in the available literature that use p779/p780 primers in C. purpureus. With the aim of providing information on the genetic and reproductive characteristics that contribute to the genetic improvement programs of C. purpureus, this study aimed to evaluate the molecular markers ASGR p779/p780, specific for aposporic apomixis, in the determination of the type of reproduction in accessions of C. purpureus from the collection of Instituto de Ciencia Animal (ICA).

Materials and Methods

 

This research was conducted in the DNA Laboratory, belonging to Future Seeds building, at the Alliance of Bioversity International and the International Center for Tropical Agriculture (Alliance), Cali, Valle del Cauca, Colombia.

Plant material: The samples under study were obtained from 62 accessions of C. purpureus, with similar regrowth age and cultivation conditions, conserved in the germplasm bank of grasses and forages, belonging to Miguel Sistachs Naya Grasses and Forage Experimental Center of Instituto de Ciencia Animal, San José de las Lajas, Mayabeque, Cuba, located at 22º 53 N and 82º 02 W at 80 m.o.s.l.

DNA extraction and amplification: The modified MATAB method (Risterucci et al. 2000Risterucci, A., Grivet, L., N’Goran, Pieretti, J., Flament, M. & Lanaud, C. 2000. A high-density linkage map of Theobroma cacao L. Theoretical and Applied Genetics, 101: 948-955, ISSN: 0040-5752. https://doi.org/10.1007/s001220051566. ) was used for genomic DNA extraction. The DNA amplification was performed by polymerase chain reaction (PCR), with the combination of direct and reverse primers p779/p780 described by Worthington et al. (2016)Worthington, M., Heffelfinger, C., Bernal, D., Quintero, C., Zapata, Y.P., Perez, J.G., De Vega, J., Miles, J., Dellaporta, S. & Tohme, J. 2016. A parthenogenesis gene candidate and evidence for segmental allopolyploidy in apomictic Brachiaria decumbens. Genetics, 203(3): 1117-1132, ISSN: 3049-7094. https://doi.org/10.1534/genetics.116.190314. (table 1).

Table 1.  List of primers and their sequences used in the study
Primer Location Sequence 5'---- 3' Source
p779 Direct 5'TATGTCACGACAAGAATATG'3 (Worthington et al. 2016Worthington, M., Heffelfinger, C., Bernal, D., Quintero, C., Zapata, Y.P., Perez, J.G., De Vega, J., Miles, J., Dellaporta, S. & Tohme, J. 2016. A parthenogenesis gene candidate and evidence for segmental allopolyploidy in apomictic Brachiaria decumbens. Genetics, 203(3): 1117-1132, ISSN: 3049-7094. https://doi.org/10.1534/genetics.116.190314. )
p780 Reverse 3'TGTAACCATAACTCTCAGCT'5

The PCR mixture was made in a final volume of 12 µL, using 4 µL of 2X Promega buffer (GoTaq® Green Master Mix), with a final concentration of 0.66X, 0.12 µL of p779 and p780, with a final concentration of 0.2 µM in each primer and 6.76 µL of ultrapure water (UltraPure DNase/RNase-Free Distilled Water, Catalog number: 10977015-Invitrogen) and 1 µL of genomic DNA with a concentration of 10 ng. As controls, DNA samples from Urochloa accessions, with apomictic and sexual reproduction, from the Genetic Resources Program of the Alliance of Bioversity International and the International Center for Tropical Agriculture, Colombia, were used (table 2).

Table 2.  Description of the apomictic and sexual controls used in the study
Species Accession Type of reproduction Control Name
U. decumbens CIAT 606 Apomictic Positive (C+)
U. ruziziensis CIAT 6713 Sexual Negative (C-)
U. ruziziensis CIAT 26168 Sexual Negative (D-)
U. brizantha CIAT 16338 Apomictic Positive (E+)
U. ruziziensis CIAT 26295 Sexual Negative (F-)
U. brizantha CIAT 16776 Apomictic Positive (G+)
U. brizantha CIAT 16447 Apomictic Positive (H+)

The amplification was performed in an Eppendorf Mastercycler Nexus Gradient Thermal Cyclers Cole-Parmer® USA thermocycler. The PCR reaction was carried out following a program of approximately 2 hours duration. The thermal profile consisted of an initial denaturation at 94°C for 5 minutes, followed by 35 cycles consisting of: denaturation at 94°C for 30 seconds, hybridization at 52°C for 30 seconds and extension at 72°C for 60 seconds. Finally, a final extension was performed at 72°C for 10 minutes to complete the synthesis of the amplified fragments.

Separation of PCR products: The amplified products were analyzed by electrophoresis on a 1.5% agarose gel prepared with GelRed (Biotium) as an intercalating agent. The run was performed in 0.5X TBE buffer at 100 V for approximately 2 hours. The 1Kb DNA Ladder molecular weight marker, INVITROGEN®, was used.

Visualization of PCR products: Visualization and analysis of the amplified DNA fragments was performed using photography, with the BIO-RAD ChemiDoc MP Imaging System Universal Hood III, USA photodocumenter.

Results and Discussion

 

The results showed that the DNA from the 62 accessions of C. purpureus and the negative controls to aposporic apomixes of U. ruziziensis did not amplify with the ASGR p779/p780 primers. However, amplification of DNA of the positive controls to the apomixes in U. decumbens and U. brizantha accessions was obtained. The amplification products showed a well-defined polymorphic band on the gels for the apomictic accessions. The amplified fragments showed an approximate size of 950 pb (figure 1).

Figure 1.  PCR products with the amplification of Urochloa spp. control positives to aposporic apomixis and the 62 C. purpureus samples without amplification with the ASGR p779/p780 primers. Controls U. decumbens (C+), U. ruziziensis (C-) (D-) (F-), U. brizantha (E+) (G+) (H+).

According to Cook et al. (2020)Cook, B.G., Pengelly, B.C., Schultze-Kraft, R., Taylor, M., Burkart, S., Cardoso Arango, J.A., González Guzmán, J.J., Cox, K., Jones, C. & Peters, M. 2020. Tropical Forages: An interactive selection tool. 2nd and Revised Edn. International Center for Tropical Agriculture (CIAT), Cali, Colombia and International Livestock Research Institute (ILRI), Nairobi, Kenya. www.tropicalforages.info. and Genesys PGR (2025)Genesys PGR. 2025. Available at: https://www.genesys-pgr.org/ [Consulted: July 15, 2025]. platform, the U. ruziziensis accessions 6713, 26168 and 26295 used as negative controls in this study are sexual reproduction materials. However, the accessions U. decumbens CIAT 606, U. brizantha, 16338, 16776 and 16447 are of apomictic reproduction. This is logical with the results obtained in the PCR. The Urochloa spp controls are important indicators in this study since they show the presence or absence of the aposporic and their diversity in species from the same genus.

The PCR results showed that for the samples of C. purpureus species there was not amplification in any of the cases. These suggest that the 62 C. purpureus accessions preserve in the ICA collection are not reproduce by aposporic apomixis; or these primers are not specific for this species since there was not positive controls for Cenchrus genus. Although the information about the use of ASGR p779/p780 primers in C. purpureus is limited can cause uncertainty on if they are compatible with the DNA pattern. However, the results of this study, could be confirm the way of sexual reproduction in C. purpureus defined by Hanna (1981)Hanna, W.W. 1981. Method of reproduction in napiergrass and in the 3x and 6x alloploid hybrids with pearl millet. Crop Science, 21: 123-126, ISSN: 1435-0653. https://doi.org/10.2135/cropsci1981.0011183X002100010033x. and González and Hanna 1984González, B. & Hanna, W.W. 1984. Morphological and fertility responses in isogenic triploid and hexaploid pearl millet x napiergrass hybrids. Journal of Heredity, 75(4): 317-318, ISSN: 1465-7333. http://jhered.oxfordjournals.org/. ) for which they used morphological markers and determined the reproductive characteristics of the C. purpureus accessions and hybrids of C. purpureus x C. americanus.

The results found in this study in the 62 C. purpureus accessions support the Akiyama et al. (2011)Akiyama, Y., Goel, S., Conner, J.A., Hanna, W.W., Yamada-Akiyama, H. & Ozias-Akins, P. 2011. Evolution of the apomixis transmitting chromosome in Pennisetum. BMC Evolutionary Biology, 11: 1-16, ISSN: 1471-2148. http://www.biomedcentral.com/1471-2148/11/289. results, which showed that the specific ASGR p779/p780 primers has a perfect link with the genomic region ASGR in others Cenchrus species and the Urochloa and Megathyrsus genus, where it was confirm their excellent diagnostic capacity for the apomictic reproductive way. Also, these primers support the hypothesis of a common origin for the aposporic apomixis in the Paniceae tribe (Akiyama et al. 2011Akiyama, Y., Goel, S., Conner, J.A., Hanna, W.W., Yamada-Akiyama, H. & Ozias-Akins, P. 2011. Evolution of the apomixis transmitting chromosome in Pennisetum. BMC Evolutionary Biology, 11: 1-16, ISSN: 1471-2148. http://www.biomedcentral.com/1471-2148/11/289. , Worthington et al. 2016Worthington, M., Heffelfinger, C., Bernal, D., Quintero, C., Zapata, Y.P., Perez, J.G., De Vega, J., Miles, J., Dellaporta, S. & Tohme, J. 2016. A parthenogenesis gene candidate and evidence for segmental allopolyploidy in apomictic Brachiaria decumbens. Genetics, 203(3): 1117-1132, ISSN: 3049-7094. https://doi.org/10.1534/genetics.116.190314. and Worthington et al. 2019Worthington, M., Ebina, M., Yamanaka, N., Heffelfinger, C., Quintero, C., Zapata, Y. P., Perez, J.G., Selvaraj, M., Ishitani, M., Duitama, J., de la Hoz, J.F., Rao, I., Dellaporta, S., Tohme, J. & Arango, J. 2019. Translocation of a parthenogenesis gene candidate to analternate carrier chromosome in apomictic Brachiaria humidicola. BMC genomics, 20(41): 1-18, ISSN: 1471-2164. https://doi.org/10.1186/s12864-018-5392-4. ).

On the other hand, the results showed that the ASGR p779/p780 primers consistency amplified the characteristic fragment of approximately 950 pb in the apomictic controls of Urochloa, while they do not generate amplification in the sexual controls either in the 62 C. purpureus accessions evaluated. This response was coherent with the reproductive performance known from the used controls and confirms the functional of the implemented PCR system (Worthington et al. 2016Worthington, M., Heffelfinger, C., Bernal, D., Quintero, C., Zapata, Y.P., Perez, J.G., De Vega, J., Miles, J., Dellaporta, S. & Tohme, J. 2016. A parthenogenesis gene candidate and evidence for segmental allopolyploidy in apomictic Brachiaria decumbens. Genetics, 203(3): 1117-1132, ISSN: 3049-7094. https://doi.org/10.1534/genetics.116.190314. and Worthington et al. 2019Worthington, M., Ebina, M., Yamanaka, N., Heffelfinger, C., Quintero, C., Zapata, Y. P., Perez, J.G., Selvaraj, M., Ishitani, M., Duitama, J., de la Hoz, J.F., Rao, I., Dellaporta, S., Tohme, J. & Arango, J. 2019. Translocation of a parthenogenesis gene candidate to analternate carrier chromosome in apomictic Brachiaria humidicola. BMC genomics, 20(41): 1-18, ISSN: 1471-2164. https://doi.org/10.1186/s12864-018-5392-4. ).

The absence of amplification in C. purpureus can interpreted based on two main hypotheses. The first, and most provable with basis in the available literature, is that the evaluated accessions have a sexual reproduction way. Classic studies performed by morphologic markers has been reported sexuality in C. purpureus and in hybrids with C. americanus (Hanna 1981Hanna, W.W. 1981. Method of reproduction in napiergrass and in the 3x and 6x alloploid hybrids with pearl millet. Crop Science, 21: 123-126, ISSN: 1435-0653. https://doi.org/10.2135/cropsci1981.0011183X002100010033x. and González and Hanna 1984González, B. & Hanna, W.W. 1984. Morphological and fertility responses in isogenic triploid and hexaploid pearl millet x napiergrass hybrids. Journal of Heredity, 75(4): 317-318, ISSN: 1465-7333. http://jhered.oxfordjournals.org/. ), which coincides with the lack of detection of the marker associated to apomixis in this study. Furthermore, comparative studies in the Cenchrus genus show that not all species possess the ASGR region or express apomixis, and that sexuality is common within the group (Akiyama et al. 2011Akiyama, Y., Goel, S., Conner, J.A., Hanna, W.W., Yamada-Akiyama, H. & Ozias-Akins, P. 2011. Evolution of the apomixis transmitting chromosome in Pennisetum. BMC Evolutionary Biology, 11: 1-16, ISSN: 1471-2148. http://www.biomedcentral.com/1471-2148/11/289. and Santos et al. 2025Santos, L., Ragalzi, C., Gesteira, G., Vilela, M., Raposo, A., Jank, L., Santos, M. & Môro, G. 2025. Performance of the molecular marker p779/p780 for classifying mode of reproduction and its association with agronomic traits in a guineagrass breeding program. Euphytica, 221(7): 113, ISSN: 1573-5060. https://doi.org/10.1007/s10681-025-03556-x. ).

The second hypothesis considers the possibility that the p779/p780 primers are not fully compatible with the genetic basis of C. purpureus. Researchers in apomictic species of Cenchrus genus has shown that the ASGR region can undergo chromosomal rearrangements or be located in different positions depending on the species (Goel et al. 2006Goel, S., Chen, Z., Akiyama, Y., Conner, J. A., Basu, M., Gualtieri, G., Hanna, W.W. & Ozias-Akins, P. 2006. Comparative physical mapping of the apospory-specific genomic region in two apomictic grasses: Pennisetum squamulatum and Cenchrus ciliaris. Genetics, 173(1): 389-400, ISSN: 3049-7094. https://doi.org/10.1534/genetics.105.054429. ), which could affect the conservation of target sequences for amplification. Additionally, although the p779/p780 marker has shown high diagnostic accuracy in species of Urochloa, Megathyrsus and some species of Cenchrus, it has also been documented that its association is not perfect in segregating populations (da Costa Lima 2023da Costa Lima Moraes, A., Mollinari, M., Ferreira, R.C.U., Aono, A., de Castro Lara, L.A., Pessoa-Filho, M., Lima Barrios, S.C., Franco Garcia, A.A., Borges do Valle, C., Pereira de Souza, A. & Vigna, B.B.Z. 2023. Advances in genomic characterization of Urochloa humidicola: exploring polyploid in heritance and apomixis. Theoretical and Applied Genetics, 136(11): 238, ISSN: 1432-2242. https://doi.org/10.1101/2023.08.31.555743. and Santos et al. 2025Santos, L., Ragalzi, C., Gesteira, G., Vilela, M., Raposo, A., Jank, L., Santos, M. & Môro, G. 2025. Performance of the molecular marker p779/p780 for classifying mode of reproduction and its association with agronomic traits in a guineagrass breeding program. Euphytica, 221(7): 113, ISSN: 1573-5060. https://doi.org/10.1007/s10681-025-03556-x. ), so its performance may vary between taxa.

In this regard, although the results support the interpretation of sexual reproduction in the evaluated accessions, it is recommended to include apomictic controls belonging to Cenchrus genus in future studies to strengthen the interspecific validation of the marker and rule out specific sequence differences. Likewise, the integration of cytoembryological analyses or genomic approaches would allow confirmation of the presence or absence of the ASGR-BBML region and further characterization of the reproduction mode of C. purpureus.

Conclusions

 

The ASGR p779/p780 primers showed a clear and specific amplification in the apomictic accessions of Urochloa spp. there was not amplification in the sexual controls or in the 62 C. purpureus accessions evaluated. These results, together with the previous evidence available for the species, suggest that the analyzed accessions of C. purpureus reproduce sexually and do not exhibit aposporic apomixis.

However, due to the lack of apomictic controls of Cenchrus genus, it is recommended to validate these results using apomictic materials of the same genus, as well as to complement this analysis with cytoembryological or genomic methods that allow for more precise confirmation of the reproduction mode in C. purpureus.

Acknowledgments

 

Thanks to the Carbon Sequestration Grant from the Alliance of Bioversity International and the International Center for Tropical Agriculture for the funding to carry out the research. To colleagues at Tropical Forages and the DNA Laboratory for their support during the research stay. To Dr. Constanza Quintero for providing the primers used in this study.

References

 

Akiyama, Y., Goel, S., Conner, J.A., Hanna, W.W., Yamada-Akiyama, H. & Ozias-Akins, P. 2011. Evolution of the apomixis transmitting chromosome in Pennisetum. BMC Evolutionary Biology, 11: 1-16, ISSN: 1471-2148. http://www.biomedcentral.com/1471-2148/11/289.

Cook, B.G., Pengelly, B.C., Schultze-Kraft, R., Taylor, M., Burkart, S., Cardoso Arango, J.A., González Guzmán, J.J., Cox, K., Jones, C. & Peters, M. 2020. Tropical Forages: An interactive selection tool. 2nd and Revised Edn. International Center for Tropical Agriculture (CIAT), Cali, Colombia and International Livestock Research Institute (ILRI), Nairobi, Kenya. www.tropicalforages.info.

da Costa Lima Moraes, A., Mollinari, M., Ferreira, R.C.U., Aono, A., de Castro Lara, L.A., Pessoa-Filho, M., Lima Barrios, S.C., Franco Garcia, A.A., Borges do Valle, C., Pereira de Souza, A. & Vigna, B.B.Z. 2023. Advances in genomic characterization of Urochloa humidicola: exploring polyploid in heritance and apomixis. Theoretical and Applied Genetics, 136(11): 238, ISSN: 1432-2242. https://doi.org/10.1101/2023.08.31.555743.

Genesys PGR. 2025. Available at: https://www.genesys-pgr.org/ [Consulted: July 15, 2025].

Goel, S., Chen, Z., Akiyama, Y., Conner, J. A., Basu, M., Gualtieri, G., Hanna, W.W. & Ozias-Akins, P. 2006. Comparative physical mapping of the apospory-specific genomic region in two apomictic grasses: Pennisetum squamulatum and Cenchrus ciliaris. Genetics, 173(1): 389-400, ISSN: 3049-7094. https://doi.org/10.1534/genetics.105.054429.

González, B. & Hanna, W.W. 1984. Morphological and fertility responses in isogenic triploid and hexaploid pearl millet x napiergrass hybrids. Journal of Heredity, 75(4): 317-318, ISSN: 1465-7333. http://jhered.oxfordjournals.org/.

Hanna, W.W. 1981. Method of reproduction in napiergrass and in the 3x and 6x alloploid hybrids with pearl millet. Crop Science, 21: 123-126, ISSN: 1435-0653. https://doi.org/10.2135/cropsci1981.0011183X002100010033x.

Kumar, S., Saxena, S., Rai, A., Radhakrishna, A. & Kaushal, P. 2019. Ecological, genetic, and reproductive features of Cenchrus species indicate evolutionary superiority of apomixis under environmental stresses. Ecological Indicators, 105: 126-136, ISSN: 1872-7034. https://doi.org/10.1016/j.ecolind.2019.05.036.

POWO. 2025. Plants of the World Online. Kew Royal Botanic Gardens. Available at: https://powo.science.kew.org/taxon/urn:lsid:ipni.org:names:77106033-1 [Consulted: July 15, 2025].

Risterucci, A., Grivet, L., N’Goran, Pieretti, J., Flament, M. & Lanaud, C. 2000. A high-density linkage map of Theobroma cacao L. Theoretical and Applied Genetics, 101: 948-955, ISSN: 0040-5752. https://doi.org/10.1007/s001220051566.

Santos, L., Ragalzi, C., Gesteira, G., Vilela, M., Raposo, A., Jank, L., Santos, M. & Môro, G. 2025. Performance of the molecular marker p779/p780 for classifying mode of reproduction and its association with agronomic traits in a guineagrass breeding program. Euphytica, 221(7): 113, ISSN: 1573-5060. https://doi.org/10.1007/s10681-025-03556-x.

Wessapak, P., Ngernsaengsaruay, C. & Duangjai, S. 2023. A taxonomic revision of Cenchrus L. (Poaceae) in Thailand, with lectotypification of Pennisetum macrostachyum Benth. PhytoKeys, 234: 1-33, ISSN: 1314-2003. https://doi.org/10.3897/phytokeys.234.106486.

Worthington, M., Ebina, M., Yamanaka, N., Heffelfinger, C., Quintero, C., Zapata, Y. P., Perez, J.G., Selvaraj, M., Ishitani, M., Duitama, J., de la Hoz, J.F., Rao, I., Dellaporta, S., Tohme, J. & Arango, J. 2019. Translocation of a parthenogenesis gene candidate to analternate carrier chromosome in apomictic Brachiaria humidicola. BMC genomics, 20(41): 1-18, ISSN: 1471-2164. https://doi.org/10.1186/s12864-018-5392-4.

Worthington, M., Heffelfinger, C., Bernal, D., Quintero, C., Zapata, Y.P., Perez, J.G., De Vega, J., Miles, J., Dellaporta, S. & Tohme, J. 2016. A parthenogenesis gene candidate and evidence for segmental allopolyploidy in apomictic Brachiaria decumbens. Genetics, 203(3): 1117-1132, ISSN: 3049-7094. https://doi.org/10.1534/genetics.116.190314.

Xu, Y., Jia, H., Tan, C., Wu, X., Deng, X. & Xu, Q. 2022. Apomixis: genetic basis and controlling genes. Horticulture Research, 9: 1-10, ISSN: 2052-7276. https://doi.org/10.1093/hr/uhac150.


 
Ciencia de los Pastos y Otros Cultivos

Evaluación de cebadores ASGR p779/p780 en la determinación de la apomixis apospórica en Cenchrus purpureus

 

iDA. R. Hernández Montesinos1Instituto de Ciencia Animal, C. Central, km 47 ½, San José de las Lajas, C.P. 32700, Mayabeque, Cuba*✉:andresraulhm@gmail.com

iDMaría E. Recio2Centro Internacional de Agricultura Tropical, km 17, Recta, Cali-Palmira, C.P.763537, Valle del Cauca, Colombia

iDMónica Carvajal-Yepes2Centro Internacional de Agricultura Tropical, km 17, Recta, Cali-Palmira, C.P.763537, Valle del Cauca, Colombia

iDJ. Arango2Centro Internacional de Agricultura Tropical, km 17, Recta, Cali-Palmira, C.P.763537, Valle del Cauca, Colombia

iDDaymara Rodríguez Alfonso3Universidad Agraria de La Habana, A. Nacional, km 23 ½, San José de las Lajas, C.P. 32700, Mayabeque, Cuba

iDDayleni Fortes González1Instituto de Ciencia Animal, C. Central, km 47 ½, San José de las Lajas, C.P. 32700, Mayabeque, Cuba

iDR. S. Herrera García1Instituto de Ciencia Animal, C. Central, km 47 ½, San José de las Lajas, C.P. 32700, Mayabeque, Cuba


1Instituto de Ciencia Animal, C. Central, km 47 ½, San José de las Lajas, C.P. 32700, Mayabeque, Cuba

2Centro Internacional de Agricultura Tropical, km 17, Recta, Cali-Palmira, C.P.763537, Valle del Cauca, Colombia

3Universidad Agraria de La Habana, A. Nacional, km 23 ½, San José de las Lajas, C.P. 32700, Mayabeque, Cuba

 

*Email: andresraulhm@gmail.com

Resumen

El objetivo del presente trabajo fue evaluar los marcadores moleculares ASGR p779/p780, específicos para apomixis apospórica, en la determinación del tipo de reproducción en accesiones de Cenchrus purpureus. El estudio se desarrolló en la Alianza de Bioversity International y el Centro Internacional de Agricultura Tropical. Las muestras en estudio provienen de 62 accesiones de C. purpureus del Banco de germoplasma de pastos y forrajes del Instituto de Ciencia Animal. Se determinó el tipo de reproducción de las accesiones mediante Reacción en Cadena de la Polimerasa (PCR) con la combinación de cebadores directo e inverso p779/p780 completamente ligados a la apomixis apospórica. No se obtuvo amplificación del ADN de las accesiones de C. purpureus y los controles Urochloa spp. negativos a la apomixis apospórica. Sin embargo, se obtuvo amplificación del ADN de los controles positivos a la apomixis apospórica en las accesiones de Urochloa spp. reportadas como apomícticas. Los productos de amplificación revelaron una banda polimórfica nítida en los geles con un tamaño aproximado de 950 pares de bases. Los cebadores p779/p780 amplificaron las accesiones de Urochloa positivas a la apomixis, pero no amplificaron los controles negativos ni las accesiones de C. purpureus. Estos resultados sugieren que (I) o las 62 accesiones de C. purpureus del ICA se reproducen de forma sexual y no presentan apomixis apospórica, o que (II) los cebadores no son específicos para esta especie.

Palabras clave: 
ADN, marcador molecular, PCR, reproducción, Urochloa

Introducción

 

La especie Cenchrus purpureus (Schumach) Morrone es nativa del África Tropical. Es un geófito perenne o rizomatoso y crece principalmente en el bioma tropical estacionalmente seco. Se utiliza como alimento para animales y en la medicina; tiene usos ambientales y sociales, y se usa como combustible (POWO 2025POWO. 2025. Plants of the World Online. Kew Royal Botanic Gardens. Available at: https://powo.science.kew.org/taxon/urn:lsid:ipni.org:names:77106033-1 [Consulted: July 15, 2025]. ). En C. purpureus se encuentran dos tipos de reproducción: sexual (por semillas) y asexual (por esquejes vegetativos) (Wessapak et al. 2023Wessapak, P., Ngernsaengsaruay, C. & Duangjai, S. 2023. A taxonomic revision of Cenchrus L. (Poaceae) in Thailand, with lectotypification of Pennisetum macrostachyum Benth. PhytoKeys, 234: 1-33, ISSN: 1314-2003. https://doi.org/10.3897/phytokeys.234.106486. ).

La apomixis es el fenómeno de reproducción clonal por semilla y ocurre de forma natural en más de 400 especies vegetales (Xu et al. 2022Xu, Y., Jia, H., Tan, C., Wu, X., Deng, X. & Xu, Q. 2022. Apomixis: genetic basis and controlling genes. Horticulture Research, 9: 1-10, ISSN: 2052-7276. https://doi.org/10.1093/hr/uhac150.). En el género Cenchrus se estima que al menos ocho especies presentan apomixis, aunque la exactitud numérica varía debido a la complejidad biológica del fenómeno y a la presencia de modos reproductivos facultativos (combinación de apomixis y sexualidad) en varias especies (Kumar et al. 2019Kumar, S., Saxena, S., Rai, A., Radhakrishna, A. & Kaushal, P. 2019. Ecological, genetic, and reproductive features of Cenchrus species indicate evolutionary superiority of apomixis under environmental stresses. Ecological Indicators, 105: 126-136, ISSN: 1872-7034. https://doi.org/10.1016/j.ecolind.2019.05.036. ).

Los estudios de identificación de la apomixis en C. purpureus, se realizaron por Hanna (1981)Hanna, W.W. 1981. Method of reproduction in napiergrass and in the 3x and 6x alloploid hybrids with pearl millet. Crop Science, 21: 123-126, ISSN: 1435-0653. https://doi.org/10.2135/cropsci1981.0011183X002100010033x. y González y Hanna (1984)González, B. & Hanna, W.W. 1984. Morphological and fertility responses in isogenic triploid and hexaploid pearl millet x napiergrass hybrids. Journal of Heredity, 75(4): 317-318, ISSN: 1465-7333. http://jhered.oxfordjournals.org/. para lo cual emplearon marcadores morfológicos y determinaron en todos los casos la forma de reproducción sexual en accesiones de C. purpureus e híbridos de C. purpureus x Cenchrus americanus (L.) Morrone. Sin embargo, la información genética sobre la presencia de las regiones genómicas que intervienen en este modo de reproducción no se ha descrito en C. purpureus.

Entre los marcadores moleculares vinculados al modo de reproducción en especies apomícticas en Poaceae, se encuentra el ASGR (apospory-specific genomic region, por sus siglas en inglés) p779/p780 específicos para apomixis apospórica. Desarrollados por Akiyama et al. (2011)Akiyama, Y., Goel, S., Conner, J.A., Hanna, W.W., Yamada-Akiyama, H. & Ozias-Akins, P. 2011. Evolution of the apomixis transmitting chromosome in Pennisetum. BMC Evolutionary Biology, 11: 1-16, ISSN: 1471-2148. http://www.biomedcentral.com/1471-2148/11/289. , a partir de secuencias de los exones cuatro y siete del gen ASGR-BBM-like2 de Pennisetum squamulatum (L.) syn. Cenchrus squamulatus (Fresen.) Morrone y que amplifica una región que incluye tres intrones de 950, 266 y 154 pares de bases (pb).

Los cebadores ASGR p779/p780 se utilizaron para determinar el modo de reproducción de accesiones de Megathyrsus maximus (Jacq.) B.K.Simon & S.W.L.Jacobs y cuatro especies de Urochloa (Urochloa brizantha (A. Rich.) R. D. Webster, Urochloa decumbens (Stapf) R. D. Webster, Urochloa humidicola (Rendle) Morrone & Zuloaga y Urochloa ruziziensis (R. Germ. & C. M. Evrard) Crins) del Programa de Recursos Genéticos de la Alianza de Bioversity International y el Centro Internacional de Agricultura Tropical (Alianza), en Colombia (Worthington et al. 2016Worthington, M., Heffelfinger, C., Bernal, D., Quintero, C., Zapata, Y.P., Perez, J.G., De Vega, J., Miles, J., Dellaporta, S. & Tohme, J. 2016. A parthenogenesis gene candidate and evidence for segmental allopolyploidy in apomictic Brachiaria decumbens. Genetics, 203(3): 1117-1132, ISSN: 3049-7094. https://doi.org/10.1534/genetics.116.190314. y Worthington et al. 2019Worthington, M., Ebina, M., Yamanaka, N., Heffelfinger, C., Quintero, C., Zapata, Y. P., Perez, J.G., Selvaraj, M., Ishitani, M., Duitama, J., de la Hoz, J.F., Rao, I., Dellaporta, S., Tohme, J. & Arango, J. 2019. Translocation of a parthenogenesis gene candidate to analternate carrier chromosome in apomictic Brachiaria humidicola. BMC genomics, 20(41): 1-18, ISSN: 1471-2164. https://doi.org/10.1186/s12864-018-5392-4. ).

Son escasos, en la literatura disponible, los estudios en los cuales se utilizan los cebadores p779/p780 en C. purpureus. Con la finalidad de aportar información sobre las características genéticas y reproductivas que contribuyan a los programas de mejoramiento genético de C. purpureus, el presente estudio tuvo como objetivo evaluar los marcadores moleculares ASGR p779/p780, específicos para apomixis apospórica, en la determinación del tipo de reproducción en accesiones de C. purpureus de la colección del Instituto de Ciencia Animal (ICA).

Materiales y Métodos

 

La presente investigación se realizó en el Laboratorio de ADN, perteneciente al edificio de Semillas del Futuro, en la Alianza de Bioversity International y el Centro Internacional de Agricultura Tropical (Alianza), Cali, Valle del Cauca, Colombia.

Material vegetal: las muestras en estudio se obtuvieron de 62 accesiones de C. purpureus, con similar edad de rebrote y condiciones de cultivo, conservadas en del banco de germoplasma de pastos y forrajes, perteneciente al Centro Experimental de Pastos y Forrajes Miguel Sistachs Naya del Instituto de Ciencia Animal, San José de las Lajas, Mayabeque, Cuba, ubicado en los 22º 53 LN y los 82º 02 LO a 80 m.s.n.m.

Extracción y amplificaciones del ADN: para la extracción del ADN genómico se utilizó el método MATAB (Risterucci et al. 2000Risterucci, A., Grivet, L., N’Goran, Pieretti, J., Flament, M. & Lanaud, C. 2000. A high-density linkage map of Theobroma cacao L. Theoretical and Applied Genetics, 101: 948-955, ISSN: 0040-5752. https://doi.org/10.1007/s001220051566. ) modificado. La amplificación del ADN se realizó mediante reacción en cadena de la polimerasa (PCR), con la combinación de cebadores directo e inverso p779/p780 descritos por Worthington et al. (2016)Worthington, M., Heffelfinger, C., Bernal, D., Quintero, C., Zapata, Y.P., Perez, J.G., De Vega, J., Miles, J., Dellaporta, S. & Tohme, J. 2016. A parthenogenesis gene candidate and evidence for segmental allopolyploidy in apomictic Brachiaria decumbens. Genetics, 203(3): 1117-1132, ISSN: 3049-7094. https://doi.org/10.1534/genetics.116.190314. (tabla 1).

Tabla 1.  Lista de cebadores y sus secuencias empleadas en el estudio
Cebador Dirección Secuencia 5'---- 3' Fuente
p779 Directo 5'TATGTCACGACAAGAATATG'3 (Worthington et al. 2016Worthington, M., Heffelfinger, C., Bernal, D., Quintero, C., Zapata, Y.P., Perez, J.G., De Vega, J., Miles, J., Dellaporta, S. & Tohme, J. 2016. A parthenogenesis gene candidate and evidence for segmental allopolyploidy in apomictic Brachiaria decumbens. Genetics, 203(3): 1117-1132, ISSN: 3049-7094. https://doi.org/10.1534/genetics.116.190314. )
p780 Inverso 3'TGTAACCATAACTCTCAGCT'5

La mezcla para la PCR se realizó en un volumen final de 12 µL, utilizando 4 µL de buffer 2X Promega (GoTaq® Green Master Mix), con una concentración final de 0.66X, 0.12 µL de p779 y p780, con una concentración final 0.2 µM en cada cebador y 6.76 μL de agua ultrapura (UltraPure DNase/RNase-Free Distilled Water, Catalog number: 10977015-Invitrogen) y 1 μL de ADN genómico con una concentración de 10 ng. Como controles se utilizaron muestras de ADN de accesiones de Urochloa, con reproducción apomíctica y sexual, del Programa de Recursos Genéticos de la Alianza de Bioversity International y el Centro Internacional de Agricultura Tropical, Colombia (tabla 2).

Tabla 2.  Descripción de los controles apomícticos y sexuales utilizados en el estudio
Especie Accesión Tipo de reproducción Control Denominación
U. decumbens CIAT 606 Apomíctica Positivo (C+)
U. ruziziensis CIAT 6713 Sexual Negativo (C-)
U. ruziziensis CIAT 26168 Sexual Negativo (D-)
U. brizantha CIAT 16338 Apomíctica Positivo (E+)
U. ruziziensis CIAT 26295 Sexual Negativo (F-)
U. brizantha CIAT 16776 Apomíctica Positivo (G+)
U. brizantha CIAT 16447 Apomíctica Positivo (H+)

La amplificación se realizó en un termociclador Eppendorf Mastercycler Nexus Gradient Thermal Cyclers Cole-Parmer® USA. La reacción de PCR se llevó a cabo siguiendo un programa de aproximadamente 2 horas de duración. El perfil térmico consistió en una desnaturalización inicial a 94 °C durante 5 minutos, seguida de 35 ciclos compuestos por: desnaturalización a 94 °C durante 30 segundos, hibridación a 52 °C durante 30 segundos y extensión a 72 °C durante 60 segundos. Finalmente, se realizó una extensión final a 72 °C durante 10 minutos para completar la síntesis de los fragmentos amplificados.

Separación de los productos de PCR: los productos amplificados se analizaron mediante electroforesis en gel de agarosa al 1.5 % preparado con GelRed (Biotium) como agente intercalante. La corrida se realizó en tampón TBE 0.5X a 100 V durante aproximadamente 2 horas. Se utilizó el marcador de peso molecular 1Kb DNA Ladder, INVITROGEN®.

Visualización de los productos de PCR: la visualización y análisis de los fragmentos amplificados de ADN se realizó mediante fotografía, con el Fotodocumentador BIO-RAD ChemiDoc MP Imaging System Universal Hood III, USA.

Resultados y Discusión

 

Los resultados evidenciaron que el ADN de las 62 accesiones de C. purpureus y los controles negativos a la apomixis apospórica de U. ruziziensis, no amplificaron con los cebadores ASGR p779/p780. Sin embargo, se obtuvo amplificación del ADN de los controles positivos a la apomixis en las accesiones de U. decumbens y U. brizantha. Los productos de amplificación revelaron una banda polimórfica nítida en los geles para las accesiones apomícticas. Los fragmentos amplificados presentaron un tamaño aproximado de 950 pb (figura 1).

Figura 1.  Productos de PCR con la amplificación de los controles de Urochloa spp. positivos a apomixis apospórica y las 62 muestras de C. purpureus sin amplificación con los cebadores ASGR p779/p780. Controles U. decumbens (C+), U. ruziziensis (C-) (D-) (F-), U. brizantha (E+) (G+) (H+)

Según Cook et al. (2020)Cook, B.G., Pengelly, B.C., Schultze-Kraft, R., Taylor, M., Burkart, S., Cardoso Arango, J.A., González Guzmán, J.J., Cox, K., Jones, C. & Peters, M. 2020. Tropical Forages: An interactive selection tool. 2nd and Revised Edn. International Center for Tropical Agriculture (CIAT), Cali, Colombia and International Livestock Research Institute (ILRI), Nairobi, Kenya. www.tropicalforages.info. y la plataforma Genesys PGR (2025)Genesys PGR. 2025. Available at: https://www.genesys-pgr.org/ [Consulted: July 15, 2025]. , las accesiones U. ruziziensis 6713, 26168 y 26295 empleadas como controles negativos en la presente investigación, son materiales de reproducción sexual. Sin embargo, las accesiones U. decumbens CIAT 606, U. brizantha, 16338, 16776 y 16447 son de reproducción apomíctica, lo que es coherente con los resultados obtenidos en la PCR. Los controles de Urochloa spp son indicadores importantes en el presente estudio ya que reflejan la presencia o ausencia de la apospória y su diversidad en especies de un mismo género.

Los resultados de la PCR demostraron que para las muestras de la especie C. purpureus no hubo amplificación del fragmento en ninguno de los casos. Esto sugiere que las 62 accesiones de C. purpureus, conservadas en la colección del ICA no se reproduce mediante apomixis apospórica; o que estos cebadores no son específicos para esta especie, ya que no se contaron con controles positivos para el género Cenchrus. Aunque la información sobre el uso de los cebadores ASGR p779/p780 en C. purpureus es limitada puede causar incertidumbre sobre si son compatibles con la plantilla de ADN. Sin embargo, los resultados del presente estudio, podrían estar confirmando el modo de reproducción sexual en C. purpureus definido por Hanna (1981)Hanna, W.W. 1981. Method of reproduction in napiergrass and in the 3x and 6x alloploid hybrids with pearl millet. Crop Science, 21: 123-126, ISSN: 1435-0653. https://doi.org/10.2135/cropsci1981.0011183X002100010033x. y González y Hanna (1984)González, B. & Hanna, W.W. 1984. Morphological and fertility responses in isogenic triploid and hexaploid pearl millet x napiergrass hybrids. Journal of Heredity, 75(4): 317-318, ISSN: 1465-7333. http://jhered.oxfordjournals.org/. para lo cual emplearon marcadores morfológicos y determinaron las características reproductivas de accesiones de C. purpureus e híbridos de C. purpureus x C. americanus.

Los resultados hallados en la presente investigación en las 62 accesiones de C. purpureus respaldaron los resultados de Akiyama et al. (2011)Akiyama, Y., Goel, S., Conner, J.A., Hanna, W.W., Yamada-Akiyama, H. & Ozias-Akins, P. 2011. Evolution of the apomixis transmitting chromosome in Pennisetum. BMC Evolutionary Biology, 11: 1-16, ISSN: 1471-2148. http://www.biomedcentral.com/1471-2148/11/289. , los cuales demostraron que los cebadores específicos ASGR p779/p780 tienen una vinculación perfecta con la región genómica ASGR en otras especies de Cenchrus y los géneros Urochloa y Megathyrsus, donde se confirmó su excelente capacidad diagnóstica para el modo reproductivo apomíctico. Además, estos cebadores apoyan la hipótesis de un origen común para la apomixis apospórica en la tribu Paniceae (Akiyama et al. 2011Akiyama, Y., Goel, S., Conner, J.A., Hanna, W.W., Yamada-Akiyama, H. & Ozias-Akins, P. 2011. Evolution of the apomixis transmitting chromosome in Pennisetum. BMC Evolutionary Biology, 11: 1-16, ISSN: 1471-2148. http://www.biomedcentral.com/1471-2148/11/289. , Worthington et al. 2016Worthington, M., Heffelfinger, C., Bernal, D., Quintero, C., Zapata, Y.P., Perez, J.G., De Vega, J., Miles, J., Dellaporta, S. & Tohme, J. 2016. A parthenogenesis gene candidate and evidence for segmental allopolyploidy in apomictic Brachiaria decumbens. Genetics, 203(3): 1117-1132, ISSN: 3049-7094. https://doi.org/10.1534/genetics.116.190314. y Worthington et al. 2019Worthington, M., Ebina, M., Yamanaka, N., Heffelfinger, C., Quintero, C., Zapata, Y. P., Perez, J.G., Selvaraj, M., Ishitani, M., Duitama, J., de la Hoz, J.F., Rao, I., Dellaporta, S., Tohme, J. & Arango, J. 2019. Translocation of a parthenogenesis gene candidate to analternate carrier chromosome in apomictic Brachiaria humidicola. BMC genomics, 20(41): 1-18, ISSN: 1471-2164. https://doi.org/10.1186/s12864-018-5392-4. ).

Por otra parte, los resultados mostraron que los cebadores ASGR p779/p780 amplificaron consistentemente el fragmento característico de aproximadamente 950 pb en los controles apomícticos de Urochloa, mientras que no generaron amplificación en los controles sexuales ni en las 62 accesiones de C. purpureus evaluadas. Esta respuesta fue coherente con el comportamiento reproductivo conocido de los controles utilizados y confirma la funcionalidad del sistema de PCR implementado (Worthington et al. 2016Worthington, M., Heffelfinger, C., Bernal, D., Quintero, C., Zapata, Y.P., Perez, J.G., De Vega, J., Miles, J., Dellaporta, S. & Tohme, J. 2016. A parthenogenesis gene candidate and evidence for segmental allopolyploidy in apomictic Brachiaria decumbens. Genetics, 203(3): 1117-1132, ISSN: 3049-7094. https://doi.org/10.1534/genetics.116.190314. y Worthington et al. 2019Worthington, M., Ebina, M., Yamanaka, N., Heffelfinger, C., Quintero, C., Zapata, Y. P., Perez, J.G., Selvaraj, M., Ishitani, M., Duitama, J., de la Hoz, J.F., Rao, I., Dellaporta, S., Tohme, J. & Arango, J. 2019. Translocation of a parthenogenesis gene candidate to analternate carrier chromosome in apomictic Brachiaria humidicola. BMC genomics, 20(41): 1-18, ISSN: 1471-2164. https://doi.org/10.1186/s12864-018-5392-4. ).

La ausencia de amplificación en C. purpureus puede interpretarse bajo dos hipótesis principales. La primera, y más probable con base en la literatura disponible, es que las accesiones evaluadas presentan un modo de reproducción sexual. Estudios clásicos realizados mediante marcadores morfológicos ya habían reportado sexualidad en C. purpureus y en híbridos con C. americanus (Hanna 1981Hanna, W.W. 1981. Method of reproduction in napiergrass and in the 3x and 6x alloploid hybrids with pearl millet. Crop Science, 21: 123-126, ISSN: 1435-0653. https://doi.org/10.2135/cropsci1981.0011183X002100010033x. y González y Hanna 1984González, B. & Hanna, W.W. 1984. Morphological and fertility responses in isogenic triploid and hexaploid pearl millet x napiergrass hybrids. Journal of Heredity, 75(4): 317-318, ISSN: 1465-7333. http://jhered.oxfordjournals.org/. ), lo cual coincide con la falta de detección del marcador asociado a la apomixis en el presente trabajo. Asimismo, estudios comparativos en el género Cenchrus indican que no todas las especies poseen la región ASGR ni expresan apomixis, y que la sexualidad es frecuente dentro del grupo (Akiyama et al. 2011Akiyama, Y., Goel, S., Conner, J.A., Hanna, W.W., Yamada-Akiyama, H. & Ozias-Akins, P. 2011. Evolution of the apomixis transmitting chromosome in Pennisetum. BMC Evolutionary Biology, 11: 1-16, ISSN: 1471-2148. http://www.biomedcentral.com/1471-2148/11/289. y Santos et al. 2025Santos, L., Ragalzi, C., Gesteira, G., Vilela, M., Raposo, A., Jank, L., Santos, M. & Môro, G. 2025. Performance of the molecular marker p779/p780 for classifying mode of reproduction and its association with agronomic traits in a guineagrass breeding program. Euphytica, 221(7): 113, ISSN: 1573-5060. https://doi.org/10.1007/s10681-025-03556-x. ).

La segunda hipótesis considera la posibilidad de que los cebadores p779/p780 no sean plenamente compatibles con el fondo genético de C. purpureus. Investigaciones en especies apomícticas del género Cenchrus han mostrado que la región ASGR puede experimentar reordenamientos cromosómicos o localizarse en posiciones distintas según la especie (Goel et al. 2006Goel, S., Chen, Z., Akiyama, Y., Conner, J. A., Basu, M., Gualtieri, G., Hanna, W.W. & Ozias-Akins, P. 2006. Comparative physical mapping of the apospory-specific genomic region in two apomictic grasses: Pennisetum squamulatum and Cenchrus ciliaris. Genetics, 173(1): 389-400, ISSN: 3049-7094. https://doi.org/10.1534/genetics.105.054429. ), lo cual podría afectar la conservación de las secuencias blanco para la amplificación. Adicionalmente, aunque el marcador p779/p780 ha demostrado alta precisión diagnóstica en especies de Urochloa, Megathyrsus y algunas especies de Cenchrus, también se ha documentado que su asociación no es perfecta en poblaciones segregantes (da Costa Lima 2023da Costa Lima Moraes, A., Mollinari, M., Ferreira, R.C.U., Aono, A., de Castro Lara, L.A., Pessoa-Filho, M., Lima Barrios, S.C., Franco Garcia, A.A., Borges do Valle, C., Pereira de Souza, A. & Vigna, B.B.Z. 2023. Advances in genomic characterization of Urochloa humidicola: exploring polyploid in heritance and apomixis. Theoretical and Applied Genetics, 136(11): 238, ISSN: 1432-2242. https://doi.org/10.1101/2023.08.31.555743. y Santos et al. 2025Santos, L., Ragalzi, C., Gesteira, G., Vilela, M., Raposo, A., Jank, L., Santos, M. & Môro, G. 2025. Performance of the molecular marker p779/p780 for classifying mode of reproduction and its association with agronomic traits in a guineagrass breeding program. Euphytica, 221(7): 113, ISSN: 1573-5060. https://doi.org/10.1007/s10681-025-03556-x. ), por lo que su desempeño puede variar entre taxones.

En este sentido, aunque los resultados respaldan la interpretación de reproducción sexual en las accesiones evaluadas, se recomienda incluir en futuros trabajos controles apomícticos pertenecientes al género Cenchrus para fortalecer la validación interespecífica del marcador y descartar diferencias específicas de secuencia. Asimismo, la integración de análisis citoembriológicos o enfoques genómicos permitiría confirmar la presencia o ausencia de la región ASGR-BBML y profundizar en la caracterización del modo de reproducción de C. purpureus.

Conclusiones

 

Los cebadores ASGR p779/p780 mostraron una amplificación clara y específica en las accesiones apomícticas de Urochloa spp. no se visualizó amplificación en los controles sexuales ni en las 62 accesiones de C. purpureus evaluadas. Estos resultados, junto con la evidencia previa disponible para la especie, sugieren que las accesiones analizadas de C. purpureus se reproducen de manera sexual y no presentan apomixis apospórica.

No obstante, debido a la falta de controles apomícticos del género Cenchrus, se recomienda validar estos resultados utilizando materiales apomícticos del mismo género, así como complementar este análisis con métodos citoembriológicos o genómicos que permitan confirmar con mayor precisión el modo de reproducción en C. purpureus.

Agradecimientos

 

A la Beca Carbon Sequestration de la Alianza de Bioversity International y el Centro Internacional de Agricultura Tropical por los fondos para realizar la investigación. A los colegas de Forrajes Tropicales y del Laboratorio de ADN por el apoyo durante la estancia de investigación. A la Dr. C. Constanza Quintero por facilitar los cebadores utilizados en este trabajo.