Introduction
⌅The species Cenchrus purpureus (Schumach) Morrone is native to Tropical Africa. It is a perennial or rhizomatous geophyte and grows mainly in the seasonally dry tropical biome. It is used as animal food and in medicine; it has environmental and social uses, and is used as fuel (POWO 2025POWO. 2025. Plants of the World Online. Kew Royal Botanic Gardens. Available at: https://powo.science.kew.org/taxon/urn:lsid:ipni.org:names:77106033-1 [Consulted: July 15, 2025]. ). In C. purpureus there are two types of reproduction: sexual (by seeds) and asexual (by vegetative cuttings) (Wessapak et al. 2023Wessapak, P., Ngernsaengsaruay, C. & Duangjai, S. 2023. A taxonomic revision of Cenchrus L. (Poaceae) in Thailand, with lectotypification of Pennisetum macrostachyum Benth. PhytoKeys, 234: 1-33, ISSN: 1314-2003. https://doi.org/10.3897/phytokeys.234.106486. ).
Apomixis is the phenomenon of clonal reproduction by seed and occurs naturally in more than 400 plant species (Xu et al. 2022Xu, Y., Jia, H., Tan, C., Wu, X., Deng, X. & Xu, Q. 2022. Apomixis: genetic basis and controlling genes. Horticulture Research, 9: 1-10, ISSN: 2052-7276. https://doi.org/10.1093/hr/uhac150.). In the genus Cenchrus, it is estimated that at least eight species exhibit apomixis, although the numerical accuracy varies due to the biological complexity of the phenomenon and the presence of facultative reproductive modes (combination of apomixis and sexuality) in several species (Kumar et al. 2019Kumar, S., Saxena, S., Rai, A., Radhakrishna, A. & Kaushal, P. 2019. Ecological, genetic, and reproductive features of Cenchrus species indicate evolutionary superiority of apomixis under environmental stresses. Ecological Indicators, 105: 126-136, ISSN: 1872-7034. https://doi.org/10.1016/j.ecolind.2019.05.036. ).
The identification studies of apomixis in C. purpureus were carried out by Hanna (1981)Hanna, W.W. 1981. Method of reproduction in napiergrass and in the 3x and 6x alloploid hybrids with pearl millet. Crop Science, 21: 123-126, ISSN: 1435-0653. https://doi.org/10.2135/cropsci1981.0011183X002100010033x. and González and Hanna (1984)González, B. & Hanna, W.W. 1984. Morphological and fertility responses in isogenic triploid and hexaploid pearl millet x napiergrass hybrids. Journal of Heredity, 75(4): 317-318, ISSN: 1465-7333. http://jhered.oxfordjournals.org/. for which they used morphological markers and determined in all cases the form of sexual reproduction in accessions of C. purpureus and hybrids of C. purpureus x Cenchrus americanus (L.) Morrone. However, genetic information on the presence of genomic regions involved in this mode of reproduction has not been described in C. purpureus.
Among the molecular markers linked to the mode of reproduction in apomictic species in Poaceae, there is the ASGR (apospory-specific genomic region) p779/p780 specific for aposporic apomixis. Developed by Akiyama et al. (2011)Akiyama, Y., Goel, S., Conner, J.A., Hanna, W.W., Yamada-Akiyama, H. & Ozias-Akins, P. 2011. Evolution of the apomixis transmitting chromosome in Pennisetum. BMC Evolutionary Biology, 11: 1-16, ISSN: 1471-2148. http://www.biomedcentral.com/1471-2148/11/289. , from sequences of exons four and seven of the ASGR-BBM-like2 gene of Pennisetum squamulatum (L.) syn. Cenchrus squamulatus (Fresen.) Morrone and which amplifies a region that includes three introns of 950, 266 and 154 base pairs (bp).
The ASGR p779/p780 primers were used to determine the mode of reproduction of accessions of Megathyrsus maximus (Jacq.) B.K.Simon & S.W.L.Jacobs and four species of Urochloa (Urochloa brizantha (A. Rich.) R. D. Webster, Urochloa decumbens (Stapf) R. D. Webster, Urochloa humidicola (Rendle) Morrone & Zuloaga and Urochloa ruziziensis (R. Germ. & C. M. Evrard) Crins) from the Genetic Resources Program of the Alliance of Bioversity International and the International Center for Tropical Agriculture (Alliance), in Colombia (Worthington et al. 2016Worthington, M., Heffelfinger, C., Bernal, D., Quintero, C., Zapata, Y.P., Perez, J.G., De Vega, J., Miles, J., Dellaporta, S. & Tohme, J. 2016. A parthenogenesis gene candidate and evidence for segmental allopolyploidy in apomictic Brachiaria decumbens. Genetics, 203(3): 1117-1132, ISSN: 3049-7094. https://doi.org/10.1534/genetics.116.190314. and Worthington et al. 2019Worthington, M., Ebina, M., Yamanaka, N., Heffelfinger, C., Quintero, C., Zapata, Y. P., Perez, J.G., Selvaraj, M., Ishitani, M., Duitama, J., de la Hoz, J.F., Rao, I., Dellaporta, S., Tohme, J. & Arango, J. 2019. Translocation of a parthenogenesis gene candidate to analternate carrier chromosome in apomictic Brachiaria humidicola. BMC genomics, 20(41): 1-18, ISSN: 1471-2164. https://doi.org/10.1186/s12864-018-5392-4. ).
There are few studies in the available literature that use p779/p780 primers in C. purpureus. With the aim of providing information on the genetic and reproductive characteristics that contribute to the genetic improvement programs of C. purpureus, this study aimed to evaluate the molecular markers ASGR p779/p780, specific for aposporic apomixis, in the determination of the type of reproduction in accessions of C. purpureus from the collection of Instituto de Ciencia Animal (ICA).
Materials and Methods
⌅This research was conducted in the DNA Laboratory, belonging to Future Seeds building, at the Alliance of Bioversity International and the International Center for Tropical Agriculture (Alliance), Cali, Valle del Cauca, Colombia.
Plant material: The samples under study were obtained from 62 accessions of C. purpureus, with similar regrowth age and cultivation conditions, conserved in the germplasm bank of grasses and forages, belonging to Miguel Sistachs Naya Grasses and Forage Experimental Center of Instituto de Ciencia Animal, San José de las Lajas, Mayabeque, Cuba, located at 22º 53 N and 82º 02 W at 80 m.o.s.l.
DNA extraction and amplification: The modified MATAB method (Risterucci et al. 2000Risterucci, A., Grivet, L., N’Goran, Pieretti, J., Flament, M. & Lanaud, C. 2000. A high-density linkage map of Theobroma cacao L. Theoretical and Applied Genetics, 101: 948-955, ISSN: 0040-5752. https://doi.org/10.1007/s001220051566. ) was used for genomic DNA extraction. The DNA amplification was performed by polymerase chain reaction (PCR), with the combination of direct and reverse primers p779/p780 described by Worthington et al. (2016)Worthington, M., Heffelfinger, C., Bernal, D., Quintero, C., Zapata, Y.P., Perez, J.G., De Vega, J., Miles, J., Dellaporta, S. & Tohme, J. 2016. A parthenogenesis gene candidate and evidence for segmental allopolyploidy in apomictic Brachiaria decumbens. Genetics, 203(3): 1117-1132, ISSN: 3049-7094. https://doi.org/10.1534/genetics.116.190314. (table 1).
| Primer | Location | Sequence 5'---- 3' | Source |
|---|---|---|---|
| p779 | Direct | 5'TATGTCACGACAAGAATATG'3 | (Worthington et al. 2016Worthington, M., Heffelfinger, C., Bernal, D., Quintero, C., Zapata, Y.P., Perez, J.G., De Vega, J., Miles, J., Dellaporta, S. & Tohme, J. 2016. A parthenogenesis gene candidate and evidence for segmental allopolyploidy in apomictic Brachiaria decumbens. Genetics, 203(3): 1117-1132, ISSN: 3049-7094. https://doi.org/10.1534/genetics.116.190314. ) |
| p780 | Reverse | 3'TGTAACCATAACTCTCAGCT'5 |
The PCR mixture was made in a final volume of 12 µL, using 4 µL of 2X Promega buffer (GoTaq® Green Master Mix), with a final concentration of 0.66X, 0.12 µL of p779 and p780, with a final concentration of 0.2 µM in each primer and 6.76 µL of ultrapure water (UltraPure™ DNase/RNase-Free Distilled Water, Catalog number: 10977015-Invitrogen) and 1 µL of genomic DNA with a concentration of 10 ng. As controls, DNA samples from Urochloa accessions, with apomictic and sexual reproduction, from the Genetic Resources Program of the Alliance of Bioversity International and the International Center for Tropical Agriculture, Colombia, were used (table 2).
| Species | Accession | Type of reproduction | Control | Name |
|---|---|---|---|---|
| U. decumbens | CIAT 606 | Apomictic | Positive | (C+) |
| U. ruziziensis | CIAT 6713 | Sexual | Negative | (C-) |
| U. ruziziensis | CIAT 26168 | Sexual | Negative | (D-) |
| U. brizantha | CIAT 16338 | Apomictic | Positive | (E+) |
| U. ruziziensis | CIAT 26295 | Sexual | Negative | (F-) |
| U. brizantha | CIAT 16776 | Apomictic | Positive | (G+) |
| U. brizantha | CIAT 16447 | Apomictic | Positive | (H+) |
The amplification was performed in an Eppendorf Mastercycler Nexus Gradient Thermal Cyclers Cole-Parmer® USA thermocycler. The PCR reaction was carried out following a program of approximately 2 hours duration. The thermal profile consisted of an initial denaturation at 94°C for 5 minutes, followed by 35 cycles consisting of: denaturation at 94°C for 30 seconds, hybridization at 52°C for 30 seconds and extension at 72°C for 60 seconds. Finally, a final extension was performed at 72°C for 10 minutes to complete the synthesis of the amplified fragments.
Separation of PCR products: The amplified products were analyzed by electrophoresis on a 1.5% agarose gel prepared with GelRed™ (Biotium) as an intercalating agent. The run was performed in 0.5X TBE buffer at 100 V for approximately 2 hours. The 1Kb DNA Ladder molecular weight marker, INVITROGEN®, was used.
Visualization of PCR products: Visualization and analysis of the amplified DNA fragments was performed using photography, with the BIO-RAD ChemiDoc MP Imaging System Universal Hood III, USA photodocumenter.
Results and Discussion
⌅The results showed that the DNA from the 62 accessions of C. purpureus and the negative controls to aposporic apomixes of U. ruziziensis did not amplify with the ASGR p779/p780 primers. However, amplification of DNA of the positive controls to the apomixes in U. decumbens and U. brizantha accessions was obtained. The amplification products showed a well-defined polymorphic band on the gels for the apomictic accessions. The amplified fragments showed an approximate size of 950 pb (figure 1).
According to Cook et al. (2020)Cook, B.G., Pengelly, B.C., Schultze-Kraft, R., Taylor, M., Burkart, S., Cardoso Arango, J.A., González Guzmán, J.J., Cox, K., Jones, C. & Peters, M. 2020. Tropical Forages: An interactive selection tool. 2nd and Revised Edn. International Center for Tropical Agriculture (CIAT), Cali, Colombia and International Livestock Research Institute (ILRI), Nairobi, Kenya. www.tropicalforages.info. and Genesys PGR (2025)Genesys PGR. 2025. Available at: https://www.genesys-pgr.org/ [Consulted: July 15, 2025]. platform, the U. ruziziensis accessions 6713, 26168 and 26295 used as negative controls in this study are sexual reproduction materials. However, the accessions U. decumbens CIAT 606, U. brizantha, 16338, 16776 and 16447 are of apomictic reproduction. This is logical with the results obtained in the PCR. The Urochloa spp controls are important indicators in this study since they show the presence or absence of the aposporic and their diversity in species from the same genus.
The PCR results showed that for the samples of C. purpureus species there was not amplification in any of the cases. These suggest that the 62 C. purpureus accessions preserve in the ICA collection are not reproduce by aposporic apomixis; or these primers are not specific for this species since there was not positive controls for Cenchrus genus. Although the information about the use of ASGR p779/p780 primers in C. purpureus is limited can cause uncertainty on if they are compatible with the DNA pattern. However, the results of this study, could be confirm the way of sexual reproduction in C. purpureus defined by Hanna (1981)Hanna, W.W. 1981. Method of reproduction in napiergrass and in the 3x and 6x alloploid hybrids with pearl millet. Crop Science, 21: 123-126, ISSN: 1435-0653. https://doi.org/10.2135/cropsci1981.0011183X002100010033x. and González and Hanna 1984González, B. & Hanna, W.W. 1984. Morphological and fertility responses in isogenic triploid and hexaploid pearl millet x napiergrass hybrids. Journal of Heredity, 75(4): 317-318, ISSN: 1465-7333. http://jhered.oxfordjournals.org/. ) for which they used morphological markers and determined the reproductive characteristics of the C. purpureus accessions and hybrids of C. purpureus x C. americanus.
The results found in this study in the 62 C. purpureus accessions support the Akiyama et al. (2011)Akiyama, Y., Goel, S., Conner, J.A., Hanna, W.W., Yamada-Akiyama, H. & Ozias-Akins, P. 2011. Evolution of the apomixis transmitting chromosome in Pennisetum. BMC Evolutionary Biology, 11: 1-16, ISSN: 1471-2148. http://www.biomedcentral.com/1471-2148/11/289. results, which showed that the specific ASGR p779/p780 primers has a perfect link with the genomic region ASGR in others Cenchrus species and the Urochloa and Megathyrsus genus, where it was confirm their excellent diagnostic capacity for the apomictic reproductive way. Also, these primers support the hypothesis of a common origin for the aposporic apomixis in the Paniceae tribe (Akiyama et al. 2011Akiyama, Y., Goel, S., Conner, J.A., Hanna, W.W., Yamada-Akiyama, H. & Ozias-Akins, P. 2011. Evolution of the apomixis transmitting chromosome in Pennisetum. BMC Evolutionary Biology, 11: 1-16, ISSN: 1471-2148. http://www.biomedcentral.com/1471-2148/11/289. , Worthington et al. 2016Worthington, M., Heffelfinger, C., Bernal, D., Quintero, C., Zapata, Y.P., Perez, J.G., De Vega, J., Miles, J., Dellaporta, S. & Tohme, J. 2016. A parthenogenesis gene candidate and evidence for segmental allopolyploidy in apomictic Brachiaria decumbens. Genetics, 203(3): 1117-1132, ISSN: 3049-7094. https://doi.org/10.1534/genetics.116.190314. and Worthington et al. 2019Worthington, M., Ebina, M., Yamanaka, N., Heffelfinger, C., Quintero, C., Zapata, Y. P., Perez, J.G., Selvaraj, M., Ishitani, M., Duitama, J., de la Hoz, J.F., Rao, I., Dellaporta, S., Tohme, J. & Arango, J. 2019. Translocation of a parthenogenesis gene candidate to analternate carrier chromosome in apomictic Brachiaria humidicola. BMC genomics, 20(41): 1-18, ISSN: 1471-2164. https://doi.org/10.1186/s12864-018-5392-4. ).
On the other hand, the results showed that the ASGR p779/p780 primers consistency amplified the characteristic fragment of approximately 950 pb in the apomictic controls of Urochloa, while they do not generate amplification in the sexual controls either in the 62 C. purpureus accessions evaluated. This response was coherent with the reproductive performance known from the used controls and confirms the functional of the implemented PCR system (Worthington et al. 2016Worthington, M., Heffelfinger, C., Bernal, D., Quintero, C., Zapata, Y.P., Perez, J.G., De Vega, J., Miles, J., Dellaporta, S. & Tohme, J. 2016. A parthenogenesis gene candidate and evidence for segmental allopolyploidy in apomictic Brachiaria decumbens. Genetics, 203(3): 1117-1132, ISSN: 3049-7094. https://doi.org/10.1534/genetics.116.190314. and Worthington et al. 2019Worthington, M., Ebina, M., Yamanaka, N., Heffelfinger, C., Quintero, C., Zapata, Y. P., Perez, J.G., Selvaraj, M., Ishitani, M., Duitama, J., de la Hoz, J.F., Rao, I., Dellaporta, S., Tohme, J. & Arango, J. 2019. Translocation of a parthenogenesis gene candidate to analternate carrier chromosome in apomictic Brachiaria humidicola. BMC genomics, 20(41): 1-18, ISSN: 1471-2164. https://doi.org/10.1186/s12864-018-5392-4. ).
The absence of amplification in C. purpureus can interpreted based on two main hypotheses. The first, and most provable with basis in the available literature, is that the evaluated accessions have a sexual reproduction way. Classic studies performed by morphologic markers has been reported sexuality in C. purpureus and in hybrids with C. americanus (Hanna 1981Hanna, W.W. 1981. Method of reproduction in napiergrass and in the 3x and 6x alloploid hybrids with pearl millet. Crop Science, 21: 123-126, ISSN: 1435-0653. https://doi.org/10.2135/cropsci1981.0011183X002100010033x. and González and Hanna 1984González, B. & Hanna, W.W. 1984. Morphological and fertility responses in isogenic triploid and hexaploid pearl millet x napiergrass hybrids. Journal of Heredity, 75(4): 317-318, ISSN: 1465-7333. http://jhered.oxfordjournals.org/. ), which coincides with the lack of detection of the marker associated to apomixis in this study. Furthermore, comparative studies in the Cenchrus genus show that not all species possess the ASGR region or express apomixis, and that sexuality is common within the group (Akiyama et al. 2011Akiyama, Y., Goel, S., Conner, J.A., Hanna, W.W., Yamada-Akiyama, H. & Ozias-Akins, P. 2011. Evolution of the apomixis transmitting chromosome in Pennisetum. BMC Evolutionary Biology, 11: 1-16, ISSN: 1471-2148. http://www.biomedcentral.com/1471-2148/11/289. and Santos et al. 2025Santos, L., Ragalzi, C., Gesteira, G., Vilela, M., Raposo, A., Jank, L., Santos, M. & Môro, G. 2025. Performance of the molecular marker p779/p780 for classifying mode of reproduction and its association with agronomic traits in a guineagrass breeding program. Euphytica, 221(7): 113, ISSN: 1573-5060. https://doi.org/10.1007/s10681-025-03556-x. ).
The second hypothesis considers the possibility that the p779/p780 primers are not fully compatible with the genetic basis of C. purpureus. Researchers in apomictic species of Cenchrus genus has shown that the ASGR region can undergo chromosomal rearrangements or be located in different positions depending on the species (Goel et al. 2006Goel, S., Chen, Z., Akiyama, Y., Conner, J. A., Basu, M., Gualtieri, G., Hanna, W.W. & Ozias-Akins, P. 2006. Comparative physical mapping of the apospory-specific genomic region in two apomictic grasses: Pennisetum squamulatum and Cenchrus ciliaris. Genetics, 173(1): 389-400, ISSN: 3049-7094. https://doi.org/10.1534/genetics.105.054429. ), which could affect the conservation of target sequences for amplification. Additionally, although the p779/p780 marker has shown high diagnostic accuracy in species of Urochloa, Megathyrsus and some species of Cenchrus, it has also been documented that its association is not perfect in segregating populations (da Costa Lima 2023da Costa Lima Moraes, A., Mollinari, M., Ferreira, R.C.U., Aono, A., de Castro Lara, L.A., Pessoa-Filho, M., Lima Barrios, S.C., Franco Garcia, A.A., Borges do Valle, C., Pereira de Souza, A. & Vigna, B.B.Z. 2023. Advances in genomic characterization of Urochloa humidicola: exploring polyploid in heritance and apomixis. Theoretical and Applied Genetics, 136(11): 238, ISSN: 1432-2242. https://doi.org/10.1101/2023.08.31.555743. and Santos et al. 2025Santos, L., Ragalzi, C., Gesteira, G., Vilela, M., Raposo, A., Jank, L., Santos, M. & Môro, G. 2025. Performance of the molecular marker p779/p780 for classifying mode of reproduction and its association with agronomic traits in a guineagrass breeding program. Euphytica, 221(7): 113, ISSN: 1573-5060. https://doi.org/10.1007/s10681-025-03556-x. ), so its performance may vary between taxa.
In this regard, although the results support the interpretation of sexual reproduction in the evaluated accessions, it is recommended to include apomictic controls belonging to Cenchrus genus in future studies to strengthen the interspecific validation of the marker and rule out specific sequence differences. Likewise, the integration of cytoembryological analyses or genomic approaches would allow confirmation of the presence or absence of the ASGR-BBML region and further characterization of the reproduction mode of C. purpureus.
Conclusions
⌅The ASGR p779/p780 primers showed a clear and specific amplification in the apomictic accessions of Urochloa spp. there was not amplification in the sexual controls or in the 62 C. purpureus accessions evaluated. These results, together with the previous evidence available for the species, suggest that the analyzed accessions of C. purpureus reproduce sexually and do not exhibit aposporic apomixis.
However, due to the lack of apomictic controls of Cenchrus genus, it is recommended to validate these results using apomictic materials of the same genus, as well as to complement this analysis with cytoembryological or genomic methods that allow for more precise confirmation of the reproduction mode in C. purpureus.